Israelis who received a "booster" have tested positive for COVID

If you are willing to take an unknow substance, are you also willing to eat something with no label, no explanation of the ingredients? No nutrition information? Would you just pick up something off the ground like a one year old and pop it in your mouth? Fools lol

And how are they going to administer this eternal vaccine shot scam ? is what I'm wondering.
The numbers involved are so huge that even if the plan is to dish out boosters at say, 6 month intervals, I can't see the current arrangements could possibly work.
The NHS with a backlog of stuff that stretches to Mars and back are not going to provide jab facilities in the longer term - they can't, even if they wanted to, they haven't the staff, the space, or the money.
Carry on the nonsense of giving shots in sports centre and burger joints ? Still need staff to give them, and staff hard to come by these days, + they would have to be retained & paid - with what ? No money left. This is assuming the shots are on the state & " free "
Private paid for shots [ making a whacking great profit like the 200% increase in the cost of mandatory tests for travellers ] ? Don't see it. Don't see it at all. Millions of people taking time off work to fork out money they haven't got, on and on and on - sheep many of them might be, but pay out of their own pockets they will not, guaranteed.
Just sayin.

It amazes me that we're still dealing with this bullshit.

The tests do not work as admitted by the CDC and in court cases around the world.

It's based on taking fluid from a sick person's lung and then picking a random sequences of genes from the sample. They did not prove that the sequence that they used is COVID or would even cause COVID in someone else.

TCGGAGATTACCGAGCATTCTATCACGTCGGCGACCACTAGTGAGCTACTGGAGCCGAGGG​GTAACGATGATGCCCCTAAGAACCTCTCGGTCGACGCAAGCGATTACACTCCTGTCACATC​ATAATCGTTTGCTATTCAGGGGTTGACCAACACCGGATAGCTTTTCACTTGAAGTATTATG​CACGACAGGGTGCGTGTACCAACTAAACCTGTTTTAACTTACCTCAGACTAGTTGGAAGTG​TGGCTAGATCTTAGCTTTCGTCACTAGAGGGCCCACGCTTAGTTTTTATGATCCATTGATC​TCCTAGACGCTGCAAGATTTGCAACCAGGCAGACTTAGCGGTAGGTCCTAGTGCAGCGGGA​CTTTTTTTCTATAGTCGTTGAGAGGAGGAGTCGTCAGACCAGATACCTTTGATGTCCTGAT​TGGAAGGACCGTTGGCCCCCGACCCTTAGACAGTGTACTCAGTTCTATAAACGAGCTATTA​GATATGAGATCCGTAGATTGAAAAGGGTGACGGAATTCGCCCGGACGCAAAAGACGGACAG​CTAGGTATCCTGAGCACGGTTGCGCGTCCGAATCAAGCTCCTCTTTACAGGCCCCGGTTTC​TGTTGGTCGTAGAGCGCAGAACGGATTGGGGGGATGTACGACAATATCTCTTAGTCACCTT​TGGGTCACGGTCTGCTACCTTACAGGAATTCAGACCGTCCTTTAATTTCCCTTGCATATAT​GTTGCGTTTCTTCGACCTTCTAACCGCACCCTTAGGACGAAGACAGATACGTTCTTACCCA​TACTCCACCGTTGGCAGCGGGATCGCATGTCCCACGTGAAACATTGCTAAACCCTCAGGCC​TCTGAGCGACAAAAGCTTTAAAGGGAAATTCGCGCCCATAACTTGGTCCGAATACGGGTTC​TAGCATCGTTCGTCTGAGTT

This is a random genetic sequence. Take a sample of letters, call it COVID and then test the world for that same sequence. We have no idea what they are really testing for. It's a total scam.

Nothing makes you immune to Covid. The vaccine does cause variants to mutate tho as what happened in India. Booster shots are therefore likely to cause a new and improved variant.
Keep an eye on Israel, what happens there is a precursor for all, they are the original vax guinea pigs

GREAT RESET

I am amazed they lived through the third shot to get tested, I am quite surprised by this actually. I wonder if by the 4th will they just drop? At some point they have to just full blown drop once injected with this crap.

maybe they will become immune on the fourth shot

for common sense and logic!

Israel Now Quarantines All Arrivals From U.S. and 41 More Countries

Arrivals to Israel will have to self-isolate for at least seven days and return at least two negative COVID tests, and anyone found breaking quarantine will be subject to a 5,000-sh fine. The U.S. ealier this week added Israel to its highest COVID risk level due to delta variant spike in cases

All American travelers arriving in Israel now have to enter quarantine for at least seven days, following the implementation of new regulations Wednesday following a spike in COVID cases locally.
...

Under the new rules, travelers from 18 countries, including the United States, Ukraine, Italy, Iceland, Germany, Netherlands, Greece, Egypt, Czech Republic, France and Tunisia, are required to quarantine for at least seven days with at least two negative COVID tests.

-50%
[link to www.haaretz.com (secure)]

whats in the booster anyways? Is it the same poison as the Pfizer and Moderna original two doses, or is it even worst crap?

Israel's COVID Cabinet to Vote on Widened Proof of Immunity Restrictions, Gathering Rules

The proposed restrictions would require Israelis aged three and older to adhere to the Green Pass rules, which involve proving immunity by presenting a negative COVID test, vaccination or recovery proof

(subscribers only)
[link to www.haaretz.com (secure)]

Moar spike proteins! Moar!

I do not believe in ANY vaccines, so obviously, I did not get the COVID vaccine.

I had a routine cardiology appointment in June at a facility/clinic 8 miles from my house. Had an EKG. My cardiologist never once asked me if I had the vaccine and never mentioned it. Said my EKG was fine.

For years he suggsted I get an IV Nuclear Stress Test. I finally said I would. It was scheduled for today...I arrived at 7:30am at the cardiology clinic.

A regular stress test shows the EKG, heartrate and blood pressure while you are walking on a treadmill. A nuclear stress test shows your physician pictures of the blood flow to the heart muscle, in addition to the EKG, heartrate and blood pressure while on the treadmill.

In order to take the pictures of your heart, you will receive an injection of a radioactive tracer through an IV. The tracer allows the Nuclear camera to take pictures of the blood flow to the heart muscle. They increase the treadmill speed to see how much exercise your heart can take. The entire process takes 3-4 hours. Treadmill, photos, etc.

----------------------

I signed the consent sheet, and as the technician opened the IV needles, I said, "I'm assuming I walk/run on the treadmill without this mask on."

She said, "No, I'm sorry. It's our policy that you keep your mask on during the entire testing."

Ridiculous!

I refused the test. I'm home.

Last Edited by nutmeg on 08/11/2021 09:59 AM

Most of the Israelis get the saline injections. They will be able to breed whereas the rest of the world will be wiped out.

Kind'a reminds me of that one Nazi soldier with a clip full of blanks.. he finally gives up & pistol whips the I_AM_AN_ILLITERATE_RACIST to death, just sayin'.

At first you don't succeed..

vac·cine
/vakˈsēn/
Learn to pronounce
noun
a substance used to stimulate the production of antibodies and provide immunity against one or several diseases, prepared from the causative agent of a disease, its products, or a synthetic substitute, treated to act as an antigen without inducing the disease.


Then by definition it is not a vaccine.

Name one vaccine that is 100% effective.

Close enough for you?

Polio

Two doses of inactivated polio vaccine (IPV) are 90% effective or more against polio; three doses are 99% to 100% effective.

[link to www.cdc.gov (secure)]

The Covid vaccines are ~95% effective. So no other vaccine is actually a vaccine unless it's 100% effective? That's ridiculous.

[link to www.nytimes.com (secure)]

These figures may differ for the Delta variant but that doesn't mean the vaccine isnt a vaccine.

[link to www.bitchute.com (secure)]

Israel is claiming the vaccine is not about preventing the virus but making the symptoms less lethal

I simply provided the definition for a Vaccine.

Let me provide it again...

vac·cine
/vakˈsēn/
Learn to pronounce
noun
a substance used to stimulate the production of antibodies and provide immunity against one or several diseases, prepared from the causative agent of a disease, its products, or a synthetic substitute, treated to act as an antigen without inducing the disease.

Notice it doesn't say it provides some immunity?

So once again, if it doesn't provide immunity it isn't a vaccine.

The polio vaccine eradicated polio, the covid "vaccine" has done absolutely nothing and it is proven ineffective by the number of fully vaccinated Israeli's that are contracting the virus.


Now go be a good little puppet and get your third booster shot. LMFAO

Yes, they have moved the goalposts.

Remember when the vaccine was touted for its abilities to prevent Covid?

Now that we are seeing the vaccinated and unvaccinated are both experiencing less lethal symptoms the goalposts will once again be moved.

So to clarify it is your position that a vaccine isnt a vaccine unless it is 100% effective.

Proof of the vaccines efficacy can be found by viewing any 'Daily New Deaths' chart.

The '95% of hospitalized Israelis were fully vaccinated' story is fake news as there is zero documented proof anywhere and it completely contradicts ALL of the actual data coming out of Israel.

You really need to state (and understand) the different types of vaccine effectiveness.

Nearly all vaccines offer almost complete protection from infection. That is, if you're vaccinated you just won't have meaningful viral load in your body. When people discuss vaccine efficacy they generally mean this.

While there are vaccinated individuals that nevertheless get infected, they tend to be in the minority of individuals where the vaccine didn't work (for some reason), rather than there being a risk for everyone.

The effectiveness for the covid vaccines tends to protection against symptomatic disease, not simply 'infection'.

This seems like a nuance -- if the vaccines stop you getting ill then they're doing their job, right?

But if you're worrying about the disease being transmitted to others (the point of vaccine passports), then really you want to be worried about infections, not simply symptomatic disease.

As the covid vaccines are performing poorly as protection against infection (the data from Israel gives a residual protection of under 25% for those vaccinated 4-6 months ago) then they will allow onward transmission of disease, and there isn't any point if using 'vaccine passports'.

Worse, most vaccines don't contribute to vaccine escape because there's no viral load in the vaccinated (the vaccines offer very good protection against infection). However, as the covid vaccines offer negligible protection against infection and the infected have high viral loads, natural selection (evolution) of the virus within the vaccinated-infected will result in very rapid vaccine escape.

It was clear right from the first results of the vaccine clinical trials that the right thing to do would be to vaccinate the most vulnerable only -- that way we would have had protection from those most liable to become seriously ill, but would have limited the speed of vaccine escape to a manageable level. Instead we vaccinated everyone in sight, resulting in the vaccine escape that will once again put the vulnerable at risk (this coming winter).

It is a disaster, and entirely avoidable if only the people in charge actually listened to science rather than playing political games with people's lives.